Jean-François Millau ¹, Omari J. Bandele ², Josiann Perron ¹, Nathalie Bastien ¹, Éric F. Bouchard ¹, Luc Gaudreau ³, Douglas A. Bell ², and Régen Drouin ^1, *

¹ Division of Genetics, Department of Pediatrics, Faculty of Medicine and Health Sciences, Université de Sherbrooke, Sherbrooke, QC J1H 5N4, Canada,
² Environmental Genomics Group, Laboratory of Molecular Genetics, National Institute of Environmental Health Sciences, Research Triangle Park, North Carolina, USA
³ Department of Biology, Faculty of Sciences, Université de Sherbrooke, Sherbrooke, QC J1K 2R1, Canada

*To whom correspondence should be addressed. Tel: +1 819 820 6827; Fax: +1 819 564 5217;
Email: regen.drouin@usherbrooke.ca

Received May 25, 2010.  Revision received October 15, 2010.  Accepted November 10, 2010.

NetworkEditors' Perspectives: "Euchromatin as a molecular target for human transcription factors".
Abstract:
Introduction:
Materials and Methods:
Results:
   Figure 1. UVB and Nutlin-3 treatment doses induce different cellular outcomes and transcription of p21.
   Figure 2. UVB and Nutlin-3 treatment doses lead to similar p53 binding patterns on naked DNA.
   Figure 3. UVB and Nutlin-3 treatments induce stress-specific p53 binding patterns in cells on chromatin.
   Figure 4. p53 binding to the –2242 bp RE is affected by HATi Garcinol.
Discussion;
   Figure 5. Models for selective p53 binding.
Supplementary Data:
Funding:
Acknowledgements:
Footnotes:
References:
Additional References:
Conclusions from: Euchromatin, Embryomas, Entropy, Enhancers, and EMT.
Further Topics:
Definitions:
 

The p53 protein is crucial for adapting programs of gene expression in response to stress. Recently, we revealed that this occurs partly through the formation of stress-specific p53 binding patterns. However, the mechanisms that generate these binding patterns remain largely unknown. It is not established whether the selective binding of p53 is achieved through modulation of its binding affinity to certain response elements (REs) or via a chromatin-dependent mechanism. To shed light on this issue, we used a microsphere assay for protein–DNA binding to measure p53 binding patterns on naked DNA. In parallel, we measured p53 binding patterns within chromatin using chromatin immunoprecipitation and DNase I coupled to ligation-mediated polymerase chain reaction footprinting. Through this experimental approach, we revealed that UVB and Nutlin-3 doses, which lead to different cellular outcomes, induce similar p53 binding patterns on naked DNA. Conversely, the same treatments lead to stress-specific p53 binding patterns on chromatin. We show further that altering chromatin remodeling using an histone acetyltransferase inhibitor reduces p53 binding to REs. Altogether, our results reveal that the formation of p53 binding patterns is not due to the modulation of sequence-specific p53 binding affinity. Rather, we propose that chromatin and chromatin remodeling are required in this process.

p53 controls cell fate in response to stress and is one of the first barriers against the process of carcinogenesis. In
response to stress, p53 binds to its response elements (REs), which follow the pattern:

5'-RRRCWWGYYYnRRRCWWGYYY-3' (R = purine; Y = pyrimidine; W = adenine or thymine), and then
regulates the transcription of genes involved in major cellular pathways (1–3). Depending on the stress context, p53 induces reversible cell cycle arrest, senescence, or apoptosis (4).

How p53 triggers stress-specific responses is an unresolved question (5). One hypothesis proposes that in response to a given stress, p53 binds only to the REs located near or within genes that need to be regulated, leading to stress-specific p53 binding patterns (see reference 6 for a review on mechanisms of transcription factor selectivity). Until now, this model remained challenged by the observation that, independent of the type of stress, p53 binds to most of its REs in cell lines (7,8). However, a recent report revealed that the absence of stress-specific p53 binding patterns might be a feature of cell lines (9,10). Moreover, using p21 and its five p53 REs as a model gene, we showed that stress-specific p53 binding patterns actually occur in human primary cells and correlate with specific p21-variant transcription profiles (11). The fact that 15% of validated p53 effector genes contain multiple p53 REs suggests that this type of regulation might occur at multiple other genomic loci (3). Altogether, these observations emphasize the fact that p53 binding patterns are an important mechanism for the regulation of p53 effector genes and the adaptive response to stress.

Currently, little is known about the formation of these stress-specific p53 binding patterns. Evidence suggests that
posttranslational modifications and/or targeting co-factors favor p53 binding to specific REs. For example, UV-induced Ser46 phosphorylation directs p53 to the promoter of pro-apoptotic genes (12), and Lys320 acetylation favors p53 binding to cell-cycle-arrest gene promoters (13). Moreover, targeting co-factors ASPP1, ASPP2 and BRN3B favor p53 binding to pro-apoptotic genes while iASPP, Hzf and BRN3A have the opposite effect (14–19). However, how these selective bindings are achieved remains largely unknown. Importantly, it is not known whether stress-induced p53 binding patterns are caused by the modulation of p53's binding affinity to RE sequences or through a chromatin-dependent mechanism.

To shed light on this issue, we exposed human normal primary and human Li-Fraumeni fibroblasts to different doses of UVB or Nutlin-3 in order to generate different p53 binding patterns and distinct cellular outcomes. We then measured p53 binding activity on naked DNA with a microsphere assay for protein–DNA binding (MAPD) (20). This multiplexed test uses nuclear extracts to quantify p53 binding to oligonucleotides containing REs. Thus, while the nuclear protein context is preserved, MAPD overcomes the effect of chromatin to assessing whether p53 binding affinity to specific RE sequences is modulated in a stress-dependent manner. In parallel, we also measured p53 binding patterns in cells on chromatinized DNA. We used chromatin immunoprecipitation (ChIP), which reveals the presence of a protein within a given region of genomic DNA, as well as DNase I digestion coupled to ligation-mediated polymerase chain reaction (PCR) footprinting (DLF), which maps protein–DNA interactions at single-nucleotide resolution and establishes the occupancy status of a RE. The combination of these techniques allowed us to investigate the influence of chromatin on the formation of p53 binding patterns. Finally, remodeling of chromatin by acetylation of nucleosomal histones is an important mechanism that regulates gene expression (21). Using the histone acetyltransferase inhibitor (HATi) Garcinol, which inhibits the histone acetyltransferases (HAT) p300 and pCAF, we investigated whether chromatin remodeling is involved in the regulation of p53 binding to REs (22).

In this article, we show that stress-specific p53 binding patterns are not caused by modulation of p53 binding affinity to specific REs. Rather, chromatin and chromatin remodeling appear to make significant contributions to the regulation of p53 binding activity and the formation of p53 binding patterns.

MATERIALS AND METHODS:

Cells and cell culture

Human normal primary skin fibroblasts (considered wild-type fibroblasts or wt) and human Li-Fraumeni (LF) skin
fibroblasts (LF041 strain, a gift from M. Tainsky, University of Texas M. D. Anderson Cancer Center, Houston, TX, USA) were grown in Dulbecco’s Modified Eagle Medium (DMEM) containing 10% FBS, 0.2?U/mL penicillin G and 100 µg/mL streptomycin, all from Wisent Bioproducts (St. Bruno, QC, Canada). LF041 fibroblasts have lost one p53 allele and carry a frameshift mutation at codon 184 in the remaining copy.

Cell treatments

UVB irradiations of 250, 500 and 2000 J/m² were performed with FS20T12/UVB/BP tubes (Philips, Franklin
Square Drive, NJ, USA); wavelengths below 290 nm were filtered by a clear 0.015-inch Kodacel TA-407 (Eastman Kodak, Rochester, NY, USA). The dose was measured using a UVX Digital Radiometer (UVP Inc., Upland, CA, USA). Induction of p53 in the absence of stress was carried out using 1, 2.5 and 10 µM of Nutlin-3 (Sigma, St. Louis, MO, USA). For the inhibition of histone acetyltransferase (HAT), cells were treated with 10, 25 and 50 µM of Garcinol (Sigma, St. Louis, MO, USA) for 2 h, then irradiated with UVB and reincubated for 12 h in the presence of Garcinol.

Cell-cycle analysis

DNA was stained using DAPI as previously described (23). DAPI fluorescent signal was quantified by laser scanning cytometry (LSC) using the iCys Research Imaging Cytometer (Compucyte, Cambridge, MA, USA) (11). A minimum of 1500 cells per experimental condition were analyzed and experiments were performed in triplicate.

Cell proliferation

5 × 10⁴ cells were seeded 24 h prior to UVB or Nutlin-3 treatments. For UVB, cells were counted 2 and 6 days
after irradiation. For Nutlin-3, cells were treated for 24 h and then grown in Nutlin-3 free medium until counting on Days 2 and 6. Experiments were performed in triplicate.

Measurement of apoptotic cells

Fibroblasts were plated 24 hr prior to UVB irradiation or incubation with Nutulin-3 for 24 hr. Cells were then harvested 48 hr post-treatment and cells were stained using the Vybrant 3 apoptosis kit (Molecular Probes, Eugene OR, USA). Apoptotic cells were then quantified using a FACScan (Becton Dickinson, San Jose, CA, USA).
                                                                                                                                                                                                                                                                                                                                                                                                          p21 mRNA quantification

The measurement of p21 mRNA was performed by qPCR as previously described (11).

Microsphere assay for protein–DNA binding

Oligonucleotides for MAPD (Invitrogen, Carlsbad, CA, USA) consisted of a forward oligonucleotide composed of 5'  ‘anti-tag’ sequences followed by p53 REs flanked with 45 nt of their respective genomic sequences (Table S1). The forward oligonucleotide was hybridized to a unique ‘tag’ sequence on each MicroPlexTM-xTAG microsphere (Luminex, Austin, TX, USA). The reverse oligonucleotide was complementary to the forward strand and biotinylated on 5'. Forward and reverse oligonucleotides and MicroPlexTM-xTAG microspheres were hybridized as previously described (20).

To evaluate p53 binding patterns, nuclear extracts were prepared using the nuclear-extract kit from Active Motif
(Carlsbad, CA, USA) and p53 binding was measured using the MAPD assay as previously described (20, 24). A
non-binding sequence (negative control WRNC) and a positive binding sequence [positive control ConC GGGCAAGTCTGGGCAAGTCT, which is a perfect match with the p53 consensus RE (25,26)] were examined in each reaction, untreated cells served as a negative control. Microspheres were multiplexed and added to p53 binding buffer supplemented with a non-competing double-stranded oligonucleotide (TransAm p53 kit, Active Motif, Carlsbad, CA, USA). Beads were incubated for 1 h in the presence of 5 µg of nuclear extracts. Microspheres were then incubated for 30 min with primary antibodies against p53 followed by a 30-min incubation with phycoerythrin-conjugated secondary antibodies. Fluorescence intensity was measured by flow cytometric analysis using a Bio-Plex® 200 System (Bio-Rad, Hercules, CA, USA). p53 binding fluorescence was normalized as previously described (20).

Immunoblotting

The blots were probed with primary antibodies (Santa Cruz Biotechnology, Inc., Santa Cruz, CA, USA) for p53
(DO-1) and actin (C-11). Bands were detected using horseradish peroxide-conjugated secondary antibodies (Santa Cruz) and the ECL Western Blotting System (Amersham Biosciences, Piscataway, NJ, USA).

Chromatin immunoprecipitation

ChIP assays were performed as previously described (27). Samples were sonicated to generate 500-bp DNA
fragments. Immunoprecipitations were carried out using anti-p53 antibody DO-1 from Santa Cruz Biotechnology
(Santa Cruz, CA, USA), anti-H3 antibody from Abcam (Cambridge, MA, USA), and anti-acetyl-H3 and
anti-acetyl-H4 antibodies from Millipore (Billerica, MA, USA). Preimmune and no antibody controls were also
performed. qPCR was done using the primer sets specific for the p53 REs located on p21 (Table S2). ChIP
experiments were performed in duplicate.

DNase I coupled to ligation-mediated PCR footprinting

DNase I footprinting reaction was carried out as previously published (11, 28). The p53 REs located on p21 were
studied using the primer sets reported in Table S3. We used ImageQuant 5.0 (Molecular Dynamics, Sunnyvale, CA, USA) to quantify sequencer TIF files (Figure S1) and determine gel-band-intensity profiles. Data were first corrected for the gel background fluorescence. For each lane, we then calculated the average band-intensity outside of the footprint area (ABIout). The ABIout was then used to normalize intensity between non-treated and treated lanes. The ratio between ABIout of non-treated lanes and treated lanes to be corrected was computed and used to normalize the intensity of treated lanes to that of the non-treated lane. Bands were identified by the presence of a local intensity maximum. Band-intensity was calculated by adding the intensity values of the 5 pixels centered on the local intensity maximum of the band. Band-intensity ratios between treated and non-treated samples were then computed, also as the 5-band-interval mobile averages (Figure S2). Negative-footprint-intensity averages were calculated by averaging the mobile-average values encompassed in the RE sequence.

RESULTS:

Choice of treatments and doses

In order to induce unique p53 binding patterns, we exposed human primary fibroblasts to distinct treatments and
treatment doses. We used 250, 500 and 2000 J/m² UVB to induce p53 accumulation following genotoxic stress. As a control, we used 1, 2.5 and 10 µM Nutlin-3 to induce p53 accumulation in the absence of stress context through the inhibition of p53-MDM2 interactions. Interestingly, UVB leads to a plethora of well-characterized p53 posttranslational modifications (29), while Nutlin-3 induces few modifications of p53 (30,31). Thus if p53 affinity to REs is modulated in a stress-specific context (e.g. posttranslational modifications or co-factors) and stress intensity, one would expect that these treatment conditions will generate distinct p53 binding patterns.

UVB and Nutlin-3 treatments lead to different cellular outcomes

We first verified the effect of treatment doses on cellular outcomes. Wild-type (wt) and LF fibroblasts were treated with UVB and Nutlin-3 doses and cell cycle, cell proliferation and apoptosis were monitored (Figure 1).

Figure 1. UVB and Nutlin-3 treatment doses induce different cellular outcomes and transcription of p21.

Figure 1. UVB and Nutlin-3 treatment doses induce different cellular outcomes and transcription of p21.
 

(A) Measurement of cell cycle. wt and LF fibroblasts were exposed to UVB and Nutlin-3 and the percentage of cells in each phase was determined 24-h post-treatment.

(B) Measurement of cell proliferation. wt and LF fibroblasts were exposed to UVB and Nutlin-3 and cells were counted at Day 2 and Day 6.

(C) Measurement of apoptotic cells. wt and LF fibroblasts were exposed to UVB and Nutlin-3 and apoptotic cells were measured 48 h post-treatment.

(D) Sequences of the different p53 RE located on the p21 gene, arrows indicate RE pentamers orientations.

(E) Measurement of p21 mRNA induction kinetic.

wt fibroblasts and LF fibroblasts were exposed to UVB and Nutlin-3 and mRNA were analyzed by means of qPCR. Arrows indicate the induction times retained to measure p53 transcriptional binding activities.

Note: All experiments were performed in triplicate and data are presented as mean ± SD.

UVB doses induced different cell-cycle-arrest responses. In wt fibroblasts, a G1/S arrest was observed following
250 J/m² while 500 J/m² arrested cells in G2/M and 2000 J/m² did not affect the cell cycle (Figure 1A). In LF
fibroblasts, both 250 J/m² and 500 J/m² doses induced a G2/M arrest while 2000 J/m² had no effect on cell-cycle
progression. The UVB doses also affected cell proliferation differently. In wt fibroblasts, cell growth was reduced
following 250 J/m², arrested by 500 J/m², and apoptosis was induced at 2000J/m² (Figure 1B and C). The
absence of p53 in LF fibroblasts sensitized the cells to UVB. The 250 J/m² dose strongly reduced cell growth while
500 and 2000 J/m² induced apoptosis (Figure 1B and C).

The cell response to Nutlin-3 led to a decrease in S phase cells through a G1/S arrest in wt fibroblasts only (Figure
1A). Cell proliferation was reduced as Nutlin-3 concentration increased but the highest dose was not sufficient to stop cell growth entirely and no apoptosis was observed (Figure 1B and C).

Thus, 250, 500 and 2000 J/m² UVB induced transient cell-cycle arrest, permanent cell-cycle arrest and apoptosis,
respectively, while 1, 2.5 and 10 µM Nutlin-3 only induced cell-cycle arrests.

Different p21 transcription profiles are induced by UVB and Nutlin-3 treatments

In order to study p53 binding patterns on different REs, we used p21 and the five p53 REs located at +3253, -1354,
-2242, -3969 and -11 708 bp from its transcription start site as a model gene (Figure 1D) (7 ,32–34). We
followed p21 mRNA levels to determine the best time conditions to measure p53 transcriptional binding activities and to investigate whether the different cellular outcomes were correlated with specific p21 transcription profiles.

UVB treatment doses induced three distinct p21 mRNA transcription profiles that correlated with the three different cellular outcomes (Figure 1E). p21 mRNA induction was lower and shorter in wt fibroblasts than in LF fibroblasts following 250 J/m², indicating that the presence of p53 repressed p21 transcription. The 500 J/m² dose led to p53-dependent induction of p21 mRNA only after 8 h in wt fibroblasts when compared with LF fibroblasts. No
augmentation of p21 mRNA level was observed following 2000 J/m² in wt or LF fibroblasts. Finally, Nutlin-3
exposure increased p21 mRNA levels in a dose-dependent manner only in wt fibroblasts (Figure 1E). Based on these transcription profiles, we decided to study p53 transcriptional activities at 2, 6 and 12 h.

UVB and Nutlin-3 treatment doses lead to similar p53 binding patterns on naked DNA

We wondered whether the formation of p53 binding patterns is caused by a stress-dependent regulation of p53 binding affinity to specific RE sequences. To answer this question, we measured p53 binding activity to the five REs of p21 in a naked DNA context using the MAPD assay and nuclear extracts of fibroblasts treated with Nutlin-3 or UVB doses (20). We observed the most intense binding with 500 J/m² UVB and 10 µM Nutlin-3 (Figures 2A and S3). For each Nutlin-3 dose, p53 binding increased in a time-dependent manner and was maximal at 12 h, while UVB-induced p53 binding reached a maximum at 6 h and decreased at 12 h for all REs (Figures 2A and S3). Since p53 protein level remained high at 12 h following UVB (Figure S4), which suggests that p53 binding activity was globally inhibited at this time, after 6 h, UVB and Nutlin-3 induced similar binding intensities between REs. The -1354 and -2242 bp REs were highly bound by p53 similar to the positive control ConC, while the -3969 and -11 708 bp REs displayed less pronounced levels of p53 binding (Figure 2A). Strikingly, no p53 binding to the +3253 bp RE was observed. Using DLF, we previously reported that we were not able to measure p53 binding to this RE in cells (11). Thus, this sequence may not be a bona fide p53 RE or is a very low affinity RE.

Figure 2. UVB and Nutlin-3 treatment doses lead to similar p53 binding patterns on naked DNA.

Figure 2. UVB and Nutlin-3 treatment doses lead to similar p53 binding patterns on naked DNA.

(A) In vitro measurement of p53 binding activities using MAPD. wt fibroblasts were exposed to 500 J/m² UVB or to 10 µM Nutlin-3 then collected at 2, 6 and 12 h for nuclear extract preparation. p53 binding to the REs located on p21 and to the positive control sequence (ConC) was measured by MAPD. Binding measured on the negative control sequence (WRNC) was subtracted from values obtained for the other REs. Experiments were performed in triplicate and data are presented as mean ± SD.

(B) Permutative comparisons of binding intensities measured by MAPD on the p53 REs located on p21
following UVB and Nutlin-3 treatment. Each data set obtained at 6 h for a treatment dose was compared with the
other doses using scatter plot representation.

(C) Permutative comparisons between p53 binding intensities obtained following 250, 500 and 2000 J/m² UVB and 10 µM Nutlin-3. Each data set obtained at 6 h for the three UVB doses was compared with the data set obtained at 6 h with 10 µM Nutlin-3. Nomenclature: open rectangle, WRNC; Y,ConC; open rhombus, +3253 bp RE; open circle, –1354 bp RE; plus symbol, –2242 bp RE; Times symbol, –3969 bp RE; open triangle, –11 708 bp RE.

Subsequently, we investigated the effect of treatment doses on p53 binding patterns. We used scatter plot
representation of data to compare the binding patterns obtained following UVB and Nutlin-3 doses. If binding patterns are similar, the RE binding intensities from two different conditions result in a correlation factor (R²) close to 1. As seen in Figure 2B, the p53 binding patterns obtained were similar for the different UVB doses tested despite the different cellular outcomes they generated (R² values ranged from 0.89 to 0.98). Only the global binding activity to all REs varied among UVB conditions, which is reflected by regression-line slopes (m) different from 1 and from each other (Figure 2B). Similar observations were made following Nutlin-3 treatments. p53 binding patterns were comparable between the different Nutlin-3 doses since R² values ranged from 0.83 to 0.99 (Figure 2B).

We then asked whether UVB- and Nutlin-3-induced p53 binding patterns were different. We compared the p53
binding obtained for the different UVB doses with the 10 µM Nutlin-3 dose (Figure 2C). The UVB doses yielded
similar p53 binding patterns to 10 µM Nutlin-3 (R² values ranging from 0.77 to 0.95). The same observations were
made when we compared the UVB doses with 1 or 2.5 µM Nutlin-3 (Figure S5).

Finally, we wondered whether these observations were valid for REs located near other genes. Using MAPD, we
measured p53 binding activities on the  83 bp and +354 bp REs of Bax and the +762 bp and +724 bp REs of
MDM2 (Figure S6). We obtained R²values close to 1, indicating that these REs were also bound similarly following
exposure to Nutlin-3 and UVB doses. Altogether, these data led to the conclusion that different treatment doses, which lead to different cellular outcomes, induce similar p53 binding patterns on naked DNA. This suggests that p53 binding affinity to specific RE sequences is not a function of the type of stress experienced by the cell.

UVB and Nutlin-3 treatments induce stress-specific p53 binding patterns in cells on chromatinized DNA

Since no p53 binding patterns were observed on naked DNA, we then investigated whether stress-specific p53 binding patterns are scored within chromatin. To this end, we used ChIP and DLF to measure p53 binding patterns on the REs located in p21 in fibroblasts following exposure to 500 J/m² UVB and 10 µM Nutlin-3 (Figure 3). We selected these treatment doses because they induced high and comparable p53 binding intensities on naked DNA (m = 0.94, Figure 2C).

Figure 3. UVB and Nutlin-3 treatments induce stress-specific p53 binding patterns in cells on chromatin.

Figure 3. UVB and Nutlin-3 treatments induce stress-specific p53 binding patterns in cells on chromatin.

wt and LF fibroblasts were exposed to UVB and Nutlin-3 then collected at 2, 6 and 12 h. p53 binding to the REs located on p21 was then measured by ChIP (white) and DLF (black).

Initially, measurement of p53 binding activity by ChIP revealed that Nutlin-3 and UVB treatments led to similar p53
binding patterns within chromatin (Figure 3). However, these data differed to what we observed on naked DNA by
several key points. For example, p53 was located at the -1354, -2242 and -11?708 bp REs, but was never found
associated to the -3969 bp RE although p53 bound this RE on naked DNA (Figures 2A and 3). Moreover, in
contrast to the results obtained with the -2242 bp RE, p53 binding to the -1354 bp RE was less intense on
chromatin than on naked DNA (Figures 2A and 3). Finally, while p53 binding activities were strongly reduced at 12 h
following UVB, as measured by MAPD (Figure 2A), ChIP revealed substantial p53 binding to REs at this time in cells.

Since no stress-specific p53 binding patterns were observed using ChIP, we used DLF to precisely investigate the
occupancy status of p53 REs (35). We did not observe any footprints in LF fibroblasts (data not shown) (11). In wt
fibroblasts, footprints were identified for the -1354, -2242 and -11 708?bp REs but not the -3969 bp RE, which
confirmed the ChIP results (Figure 3). However, following Nutlin-3 treatments, p53 was detected at the -11 708 bp
RE by ChIP, but no occupancy of this RE was measured by DLF. Although DLF is less sensitive than ChIP (footprints are rarely observed below 0.1% of ChIP input), we ruled out any sensitivity issue regarding this result since DLF was capable of measuring p53 binding to the -11 708 bp RE following UVB. Thus, conversely to experiments performed on naked DNA, stress-specific p53 binding patterns were observed on chromatinized DNA using DLF. Altogether, these data indicate that chromatin affects p53?s interaction with REs and is important for the formation of p53 binding patterns.

UVB doses modulate p53 binding to the -2242 bp RE, and accessibility to this RE is affected by HATi Garcinol

We next decided to investigate how p53 binding patterns are modulated in cells following different UVB doses that
induce distinct cellular outcomes. Using DLF, we compared p53 binding activities following 500 and 2000 J/m² UVB, which induce cell-cycle arrest and apoptosis, respectively. We observed that the -2242 bp RE was the only RE bound differently following these treatments (Figure 4A). As reported above, no specific modulation of p53 binding affinity was observed on naked DNA following 500 and 2000 J/m² UVB for this RE (Figure 2B). Since we observed that chromatin is important for the formation of p53 binding patterns, we investigated if chromatin remodeling, such as histone acetylation, could modulate p53's interaction with REs. To this end, we used HATi Garcinol, which is a well-characterized inhibitor of histone acetyltransferases p300 and pCAF (22). wt fibroblasts were pre-treated for 2 h with 0–50 µM of Garcinol, exposed to 500 J/m² UVB, and then reincubated for 12 h in the presence of Garcinol before being collected. We first measured if Garcinol treatment affected p53 levels. We observed that this was not the case (Figure 4B). As p53 is a target of HAT and since acetylation of p53 might affect its interaction with REs, we used MAPD to determine whether HATi Garcinol had an effect on p53 binding activity on naked DNA. We observed that inhibition of HAT increased p53 binding activity to all REs on naked DNA as observed for the -2242 bp RE on Figure 4C. We then investigated the effect of HATi Garcinol on p53 binding activity on chromatinized DNA in cells. To this end, we monitored p53 binding to the -2242 bp RE in wt fibroblasts using DLF (Figure 4D and E). We observed that inhibition of HAT alone had no effect on the occupancy of the -2242 bp RE (Figure 4D compare lanes 5 and 6, Figure 4E). However, following UVB treatment, the occupancy of the -2242 bp RE strongly decreased as Garcinol concentration increased (Figure 4D and E); this was also confirmed by ChIP (Figure S7). Thus, in contrast to the results obtained on naked DNA, inhibition of HAT decreases p53 interaction with the -2242 bp RE in a chromatinized DNA context. To assess whether chromatin remodeling was affected by HATi Garcinol, we monitored histone H3 and H4 acetylation levels by ChIP (Figure 4F). At the actively bound -2242 bp RE, histones H3 and H4 were acetylated in non-stressed cells and acetylation increased following exposure to UVB. On the other hand, the acetylation level of histones located at the -3969 bp RE remained very low even after UVB irradiation. Interestingly, in the presence of HATi Garcinol a decrease in histone acetylation was observed. We thus concluded that p53's interaction with REs is correlated with the acetylation level of histones.

Figure 4. p53 binding to the –2242 bp RE is affected by HATi Garcinol.

Figure 4. p53 binding to the –2242 bp RE is affected by HATi Garcinol.

(A) Comparison of p53 binding activities on p21 following UVB irradiation. p53 binding to the –1354, –2242 and –11 708 bp REs was measured by DLF in wt fibroblasts exposed to 500 and 2000 J/m² UVB.

(B) Effect of Garcinol on p53 protein levels in wt fibroblasts exposed to UVB. p53 levels were measured by western blot.

(C) Effect of Garcinol on p53 binding in vitro on naked DNA following UVB irradiation. p53 binding to the –2242 bp RE was measured by MAPD.

(D) Effect of Garcinol on p53 binding in cells on chromatin following UVB irradiation. p53 binding to the –2242 bp RE was measured in wt fibroblasts using DLF. The gel obtained using an automated sequencer is presented, negative footprints are indicated by a bar.

(E) Quantification of negative footprint intensity measured by DLF at the –2242 bp RE.

(F) Effect of Garcinol on histone H3 and histone H4 acetylation following UVB irradiation. Levels of histone H3, acetylated histone H3 (H3Ac), and acetylated histone H4 (H4Ac) were measured by ChIP at the –2242 and –3969 bp REs.

Results are expressed as ratios of acetylated histone on histone H3.

How p53 achieves specific gene regulation in response to stress is an unresolved and exciting question in the field. We and others recently showed that different stresses trigger different p53 binding patterns in primary cells (9 ,11). We demonstrated that p53 binds differently to the multiple REs located on the p21 gene to regulate p21 variant
transcriptions, revealing the crucial role of p53 binding patterns in the adaptive response to stress (11). However, the mechanism that produces these binding patterns remained largely unknown. Here, we showed that the formation of p53 binding patterns is not caused by a stress-dependent modulation of p53 binding affinity to RE sequences. Rather, we demonstrated that chromatin is needed for the formation of p53 binding patterns and that chromatin remodeling influences p53 interaction with REs.

Several lines of evidence support the view that posttranslational modifications of p53 and targeting co-factors direct
p53 to bind to certain REs in a stress-dependent manner (12–19). The modulation of p53 binding affinity to specific RE sequences is one mechanism proposed to explain how posttranslational modifications and targeting co-factors direct p53 binding to generate p53 binding patterns. The results reported in this article suggest that this is not the case. The p53 binding patterns observed on naked DNA remained virtually identical following UVB and Nutlin-3 treatments, known to induce different p53 posttranslational modifications and leading to different cellular outcomes. This observation raises questions about how posttranslational modifications and targeting co-factors direct p53 binding. Since we only observed stress-specific p53 binding patterns within chromatin, we propose that posttranslational modifications and the targeting of co-factors most likely requires the presence of chromatin to influence p53 binding to certain REs. In support of this view, crosstalk between p53 modifications and histone H3 modifications have been recently observed, suggesting that histones might play a role in the regulation of p53 functions (36). Nevertheless, it has also been shown that p53 acetylated on Lys120 is specifically found at cell-cycle-arrest genes, but this modificationis induced at a post-binding level (37,38). Thus, an important point that needs to be addressed, regarding the role of posttranslational modifications in p53 targeting, is whether they effectively direct p53 to specific REs or whether they are induced at specific REs as a post-binding event.

One admitted view is that binding affinity and protein concentration are two crucial factors regulating protein interactions with DNA. Indeed, if binding affinity is high, the protein will bind even if it is present at a lower concentration. While on the other hand, if the binding affinity is low, the protein will bind if the concentration is high (6). Since we did not observe a stress-dependent modulation of p53 binding affinity to specific RE, this suggests that regulation of concentration might be a more important factor than regulation of affinity for controlling p53 binding. Interestingly, we observed a global regulation of p53 binding activity to REs on naked DNA. Indeed, p53 binding to all REs was virtually abrogated 12 h following UVB exposure, even if p53 levels remained high. Interestingly, a regulatory mechanism of this kind might be useful to stop the p53 response to stress. Nevertheless, while we observed a global decrease in p53 binding activity, we found that high levels of p53 bound to REs were maintained in cells. Thus, despite the loss of binding activity of late accumulated p53, REs remained occupied by p53 induced at early response stages. This indicates that the global inhibition of p53 binding only circumvents p53 interaction with new REs, which might be a mechanism to prevent the regulation of novel p53 effector genes.

Of note, our results revealed that chromatin is needed for the modulation of p53's binding to REs and the formation of p53 binding patterns. This is particularly well illustrated by the absence of p53 binding to the -11 708 bp RE
following Nutlin-3 or to the -3969 bp RE following UVB and Nutlin-3 treatments in cells. Regarding the -3969 bp
RE, the absence of binding in cells clearly indicates that accessibility to this RE seems to be blocked in a chromatinized context. It is noteworthy that stress-specific p53 binding to the -11 708 bp RE was only revealed by DLF and not by ChIP. We ruled out any sensitivity issue of DLF and attributed this discrepancy to the ability of p53 to interact with other DNA-binding proteins such as SP1 and WT1 (39,40). Interestingly, a potential SP1 RE
(5'-ggGGGCTGTGTaggt-3') is located close to the -11 708 bp RE at -12 007 bp. Thus, if p53 locates only at
the SP1 RE, ChIP might not be able to differentiate between binding to the -11 708 bp p53 RE and binding to the
-12?007 bp SP1 RE, since DNA fragments encompassing both sites could have been immuno-precipitated. This
might explain the conflicting ChIP and DLF data and shows the limitations of each technique and the advantage of
combining both approaches.

One intriguing question is the role of the multiple REs present in the p21 promoter. We and others proposed that the -1354 and -2242-bp REs might be involved in the regulation of p21 variant transcription (11, 41). The proximity of the -11 709 bp RE to the p21 gene also suggests that it might act as a distal regulator through DNA looping (11). However, Huarte et al. (42) recently showed that this RE is involved in the regulation of an intergenic non-coding RNA that favors apoptosis. Interestingly, both functions for the -11 708 bp RE might not be mutually exclusive and we think that a co-dependent regulation of both loci could provide a mechanism to select between cell-cycle arrest and apoptosis outcomes.

Finally, the involvement of chromatin remodeling in the modulation of p53 binding to REs was strongly reinforced by the observation that the inhibition of histone acetylation by HATi Garcinol correlates with a decrease of p53 binding to REs in response to stress. Since histone modifications and chromatin remodeling do occur in a stress-specific manner (43), we propose that the formation of stress-specific p53 binding patterns could be directed by the remodeling of chromatin (e.g. histone acetylation). For example, the HAT p300 [which is recruited by p53 (44,45)], might only be active at certain promoters and thus increase histone acetylation levels to maintain p53 interaction only at specific REs. We thus propose a model in which chromatin acts as a filter to allow p53 binding to specific REs, over a model in which p53 binding patterns are caused by the modulation of p53's affinity to specific REs (Figure 5). Interestingly, the deregulation of histone modification and chromatin remodeling does occur during the carcinogenesis process (46,47). In the perspective provided by our results, this indicates that cancerous cells are capable of disrupting p53 binding patterns and in consequence p53's response to stress. This mechanism may disrupt the p53 pathway in p53+/+ cancerous cells and explain why p53 binding patterns differ between cancer cells and primary cells (9–11).

Figure 5. Models for selective p53 binding.

Figure 5. Models for selective p53 binding.

In the model presented in (A), the formation of p53 binding patterns is driven by the binding affinity of p53 for RE sequences. It is proposed that p53 binding affinity to REs is modulated by stress-specific posttranslational modifications that favor binding to certain REs (red).

In this model, p53 binding patterns should be observed on naked DNA. However, in our experimental setting, p53 binding patterns were virtually identical on naked DNA following the different treatments tested.

We thus propose another model (B) where the affinity of p53 for specific RE sequences is not modulated differently following stresses, rather, the selectivity of p53 binding is dependent on the remodeling of chromatin (e.g. histone acetylation) at certain REs (red).

Supplementary Data are available at NAR Online:

http://nar.oxfordjournals.org/content/39/8/3053/suppl/DC1

FUNDING:

The Canada Research Chair Program (‘Genetics, Mutagenesis and Cancer’ to R.D. and ‘Mechanisms of Gene
Transcription’ to L.G.); the Canadian Institutes of Health Research (to L.G.); and the Intramural Research Program of the National Institute of Environmental Health Sciences, National Institutes of Health (ZO1-ES-100475 and Z01
ES065079 to O.J.B. and D.A.B.); Foundation of Stars, post-doctoral fellowship (to J.-F.M.); Parts of the research
were carried out in facilities funded by grants from the Canadian Foundation for Innovation and from the Centre de
Recherche Clinique Étienne-Le Bel of the CHUS. Funding for open access charge: Canada Research Chair Program ( ‘Genetics, Mutagenesis and Cancer’ to R.D.).

Conflict of interest statement. None declared.

ACKNOWLEDGEMENTS:

We are very grateful to Drs Liette Laflamme and Léonid Volkov for their valuable technical support. The funders
played no role in study design, data collection and analysis, decision to publish, or preparation of the article.

Footnotes:

     †This article is dedicated to the memory of our colleague and friend, Dr Kada Krabchi, who passed away on 1
     August 2010.

     © The Author(s) 2010. Published by Oxford University Press.

This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial
License (http://creativecommons.org/licenses/by-nc/2.5), which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

REFERENCES:

   1. Millau JF, Bastien N, Drouin R
     P53 transcriptional activities: a general overview and some thoughts. Mutat. Res. 2009;681:118-133.

   2. el-Deiry WS, Kern SE, Pietenpol JA, Kinzler KW, Vogelstein B
     Definition of a consensus binding site for p53. Nat. Genet. 1992;1:45-49.

   3. Riley T, Sontag E, Chen P, Levine A
     Transcriptional control of human p53-regulated genes. Nat. Rev. Mol. Cell. Biol. 2008;9:402-412.

   4. Vousden KH, Lu X
     Live or let die: the cell's response to p53. Nat. Rev. Cancer 2002;2:594-604.

   5. Vousden KH, Prives C
     Blinded by the light: the growing complexity of p53. Cell 2009;137:413-431.

   6. Pan Y, Tsai CJ, Ma B, Nussinov R
     Mechanisms of transcription factor selectivity. Trends Genet. 2010;26:75-83.

   7. Wei CL, Wu Q, Vega VB, Chiu KP, Ng P, Zhang T, Shahab A, Yong HC, Fu Y, Weng Z, et al
     A global map of p53 transcription-factor binding sites in the human genome. Cell 2006;124:207-219.

   8. Espinosa JM
     Mechanisms of regulatory diversity within the p53 transcriptional network. Oncogene 2008;27:4013-4023.

   9. Shaked H, Shiff I, Kott-Gutkowski M, Siegfried Z, Haupt Y, Simon I
     Chromatin immunoprecipitation-on-chip reveals stress-dependent p53 occupancy in primary normal
     cells but not in established cell lines. Cancer Res. 2008;68:9671-9677.

  10. Millau JF, Mai S,B astien N, Drouin R
     p53 functions and cell lines: have we learned the lessons from the past? BioEssays 2010;32:392-400.

  11. Millau JF, Bastien N, Bouchard EF, Drouin R
     p53 Pre- and post-binding event theories revisited: stresses reveal specific and dynamic p53-binding
     patterns on the p21 gene promoter. Cancer Res. 2009;69:8463-8471.

  12. da K, Arakawa H, Tanaka T, Matsuda K, Tanikawa C, Mori T, Nishimori H, Tamai K, Tokino T, Nakamura Y, et al
     p53AIP1, a potential mediator of p53-dependent apoptosis, and its regulation by Ser-46-phosphorylated
     p53. Cell 2000;102:849-862.

  13. Knights CD, Catania J, Di Giovanni S, Muratoglu S, Perez R, Swartzbeck A, Quong AA, Zhang X, Beerman T, Pestell RG, et al
     Distinct p53 acetylation cassettes differentially influence gene-expression patterns and cell fate. J. Cell.
     Biol. 2006;173:533-544.

  14. Samuels-Lev Y, O'Connor DJ, Bergamaschi D, Trigiante G,
        Hsieh JK, Zhong S, Campargue I, Naumovski L, Crook T, Lu X
     ASPP proteins specifically stimulate the apoptotic function of p53. Mol. Cell 2001;8:781-794.

  15. Bergamaschi D, Samuels Y, O'Neil NJ, Trigiante G, Crook T, Hsieh JK, O'Connor DJ, Zhong S, Campargue I, Tomlinson ML, et al
     iASPP oncoprotein is a key inhibitor of p53 conserved from worm to human. Nat. Genet.
     2003;33:162-167.

  16. Bergamaschi D, Samuels Y, Sullivan A, Zvelebil M, Breyssens H, Bisso A, Del Sal G, Syed N, Smith P,
       Gasco M, et al
     iASPP preferentially binds p53 proline-rich region and modulates apoptotic function of codon
     72-polymorphic p53. Nat. Genet. 2006;38:1133-1141.

  17. Budhram-Mahadeo VS, Bowen S, Lee S, Perez-Sanchez C, Ensor E, Morris PJ, Latchman DS
     Brn-3b enhances the pro-apoptotic effects of p53 but not its induction of cell cycle arrest by cooperating
     in trans-activation of bax expression. Nucleic Acids Res. 2006;34:6640-6652.

  18. Budram-Mahadeo V, Morris PJ, Latchman DS
     The Brn-3a transcription factor inhibits the pro-apoptotic effect of p53 and enhances cell cycle arrest by
     differentially regulating the activity of the p53 target genes encoding Bax and p21(CIP1/Waf1).
     Oncogene 2002;21:6123-6131.

  19. Das S, Raj L, Zhao B, Kimura Y, Bernstein A, Aaronson SA, Lee SW
     Hzf Determines cell survival upon genotoxic stress by modulating p53 transactivation. Cell
     2007;130:624-637.

  20. Noureddine MA, Menendez D, Campbell MR, Bandele OJ, Horvath MM, Wang X, Pittman GS,
        Chorley BN, Resnick MA, Bell DA
     Probing the functional impact of sequence variation on p53-DNA interactions using a novel
     microsphere assay for protein-DNA binding with human cell extracts. PLoS Genet. 2009;5:e1000462.

  21. Li B, Carey M, Workman JL
     The role of chromatin during transcription. Cell 2007;128:707-719.

  22. Balasubramanyam K, Altaf M, Varier RA, Swaminathan V, Ravindran A, Sadhale PP, Kundu TK
     Polyisoprenylated benzophenone, garcinol, a natural histone acetyltransferase inhibitor, represses
     chromatin transcription and alters global gene expression. J. Biol. Chem. 2004;279:33716-33726.

  23. Rochette PJ, Bastien N, Lavoie J, Guerin SL, Drouin R
     SW480, a p53 double-mutant cell line retains proficiency for some p53 functions. J. Mol. Biol.
     2005;352:44-57.

  24. Jordan JJ,Menendez D, Inga A, Noureddine M, Bell DA, Resnick MA
     Noncanonical DNA motifs as transactivation targets by wild type and mutant p53. PLoS Genet.
     2008;4:e1000104.

  25. Cho Y, Gorina S, Jeffrey PD, Pavletich NP
     Crystal structure of a p53 tumor suppressor–DNA complex: understanding tumorigenic mutations.
     Science 1994;265:346-355.

  26. Inga A, Storici F, Darden TA, Resnick MA
     Differential transactivation by the p53 transcription factor is highly dependent on p53 level and
     promoter target sequence. Mol. Cell. Biol. 2002;22:8612-8625.

  27. Gevry N, Chan HM, Laflamme L, Livingston DM, Gaudreau L
     p21 transcription is regulated by differential localization of histone H2A.Z. Genes Dev.
     2007;21:1869-1881.

  28. Drouin R, Therrien JP, Angers M, Ouellet S
     In vivo DNA analysis. Methods Mol. Biol. 2001;148:175-219.

  29. Olsson A, Manzl C, Strasser A, Villunger A
     How important are post-translational modifications in p53 for selectivity in target-gene transcription
     and tumour suppression? Cell Death Differ. 2007;14:1561-1575.

  30. Vassilev LT, Vu BT, Graves B, Carvajal D, Podlaski F, Filipovic Z, Kong N, Kammlott U, Lukacs C,
       Klein C, et al
     In vivo activation of the p53 pathway by small-molecule antagonists of MDM2. Science
     2004;303:844-848.

  31. Thompson T, Tovar C, Yang H, Carvajal D, Vu BT, Xu Q, Wahl GM, Heimbrook DC, Vassilev LT
     Phosphorylation of p53 on key serines is dispensable for transcriptional activation and apoptosis. J.
     Biol. Chem. 2004;279:53015-53022.

  32. el-Deiry WS, Tokino T, Waldman T, Oliner JD, Velculescu VE, Burrell M, Hill DE, Healy E, Rees JL,
       Hamilton SR, et al
     Topological control of p21WAF1/CIP1 expression in normal and neoplastic tissues. Cancer Res.
     1995;55:2910-2919.

  33. Saramaki A, Banwell CM, Campbell MJ, Carlberg C
     Regulation of the human p21(waf1/cip1) gene promoter via multiple binding sites for p53 and the
     vitamin D3 receptor. Nucleic Acids Res. 2006;34:543-554.

  34. Nozell S, Chen X
     p21B, a variant of p21(Waf1/Cip1), is induced by the p53 family. Oncogene 2002;21:1285-1294.

  35. Drouin R, Bastien N, Millau JF, Vigneault F, Paradis I
     In cellulo DNA analysis (LMPCR footprinting). Methods Mol. Biol. 2009;543:293-336.

  36. Warnock LJ, Adamson R, Lynch CJ, Milner J
     Crosstalk between site-specific modifications on p53 and histone H3. Oncogene 2008;27:1639-1644.

  37. Sykes SM, Mellert HS, Holbert MA, Li K, Marmorstein R, Lane WS, McMahon SB
     Acetylation of the p53 DNA-binding domain regulates apoptosis induction. Mol. Cell 2006;24:841-851.

  38. Tang Y, Luo J, Zhang W, Gu W
     Tip60-dependent acetylation of p53 modulates the decision between cell-cycle arrest and apoptosis.
     Mol. Cell 2006;24:827-839.

  39. Koutsodontis G, Tentes I, Papakosta P, Moustakas A, Kardassis D
     Sp1 plays a critical role in the transcriptional activation of the human cyclin-dependent kinase inhibitor
     p21(WAF1/Cip1) gene by the p53 tumor suppressor protein. J. Biol. Chem. 2001;276:29116-29125.

  40. Zhan Q, Chen IT, Antinore MJ, Fornace AJ Jr.
     Tumor suppressor p53 can participate in transcriptional induction of the GADD45 promoter in the
     absence of direct DNA binding. Mol. Cell. Biol. 1998;18:2768-2778.

  41. Radhakrishnan SK, Gierut J, Gartel AL
     Multiple alternate p21 transcripts are regulated by p53 in human cells. Oncogene 2006;25:1812-1815.

  42. Huarte M, Guttman M, Feldser D, Garber M, Koziol MJ, Kenzelmann-Broz D, Khalil AM, Zuk O,
        Amit I, Rabani M, et al
     A large intergenic noncoding RNA induced by p53 mediates global gene repression in the p53 response.
     Cell142:409-419.

  43. Johnson AB, Barton MC
     Hypoxia-induced and stress-specific changes in chromatin structure and function. Mutat. Res.
     2007;618:149-162.

  44. Avantaggiati ML, Ogryzko V, Gardner K, Giordano A, Levine AS, Kelly K
     Recruitment of p300/CBP in p53-dependent signal pathways. Cell 1997;89:1175-1184.

  45. Espinosa JM, Emerson BM
     Transcriptional regulation by p53 through intrinsic DNA/chromatin binding and site-directed cofactor
     recruitment. Mol. Cell 2001;8:57-69.

  46. Fog CK, Jensen KT, Lund AH
     Chromatin-modifying proteins in cancer. Apmis 2007;115:1060-1089.

  47. Thorne JL, Campbell MJ, Turner BM
     Transcription factors, chromatin and cancer. Int. J. Biochem. Cell. Biol. 2009;41:164-175.

In this highly-detailed analysis by Jean-François Millau, Omari Bandele, Josiann Perron, Nathalie Bastien, Éric Bouchard, Luc Gaudreau, Douglas Bell, and Régen Drouin, it is demonstrated that  certain transcription factors require the chromatin structure of DNA rather than the naked structure of DNA for gene transcription.

Within mammalian cells during interphase, DNA is found within extended 10 nm microfibrils of  active euchromatin, and within compacted masses of  repressed heterochromatin. Naked DNA, free of all proteins, RNAs and/or lipids, is usually not found within intact cells. This new data now strongly suggests that the chromatin state of DNA is required for normal gene transcription and gene regulation.

Additional References:

1. Frenster JH, Allfrey VG, and Mirsky AE,
"Repressed and Active Chromatin Isolated from Interphase Lymphocytes."
Proc. Natl. Acad. Sciences, U.S.A, Vol. 50, No. 6, pp. 1026-1032 (Dec. 1963).

2. Frenster JH,
"Ultrastructural Continuity between Active and Repressed Chromatin",
Nature 205: 1341 (1965).

3. Frenster JH,
"Mechanisms of Repression and De-Repression within Interphase Chromatin",
In-Vitro 1: pp. 78-101 (1965).

4. Frenster JH, and Hovsepian JA,
"Models of successive levels of resolution during individual gene transcription".

5. Frenster JH, and Hovsepian JA,
 "Micro RNAs and adult neoplasms of embryonic type".
 

1. Each cell retains all of its embryonic genes for a lifetime.

2. Controls for embryonic genes are often absent in adults.

3. Uncontrolled embryonic genes can replicate wildly.

4.  Replicating genes participate in  intra-cellular competition.

5.  The basis for gene competition is selective transcription.

6.  MicroRNAs can reprogram embryomic transcription.

7.  Gene reprogramming can produce normal phenotypes.

8.  Normal phenotypes can by-pass chromosomal lesions.

9.  MicroRNA therapy may need to be permanent.

10. Transplantation of microRNAs could be preferred.

http://www.embryomas.net/

1. Pathways within cell genomes involve a flow of information.

2. Information can flow by direct contact or by third parties.

3. Direct contact within whole genomes is difficult to regulate.

4. DNA-DNA direct contects are influenced by agents.

5. Nuclear agents include hydrophilic ionic and hydrophobic conforming ligands.

6. Third parties within genomes involve RNAs and proteins.

7.  RNAs and proteins are easy to regulate or reverse.

8.  Information can be shared, lost, or transformed.

9. System information can be hidden during system isolation.

10.  Local information can be permanently lost during system entropy.

http://www.cancerbiophysics.net/

Links to Current Research in Euchromatin:
Links to Euchromatin Activator RNA Reviews:
Links to Euchromatin Activator RNA Research:
Links to Ultrastructural Probes of DNase I-Sensitive Sites:
Links to RNA as a Therapeutic Agent:
Links to Hodgkin Lymphoma Immuno-Pathology:
Links to Activated T-Lymphocyte Immunotherapy:
Links to Medical Systems Biology:
Links to Selective Gene Transcription:
Links to RNA-Induced Epigenetics:
Links to RNA-Induced Embryogenesis:
Links to RNA and Biological Causality:
Links to Reprogramming and Neoplasia:

A Brief History of Activator RNA:

"Ultrastructural Probes of Active DNA Sites, and the RNA Activators of DNA".
(PowerPoint Presentation).

Top of Page - Euchromatin Network -  Euchromatin Research -  Research in Quantitative Radiology

For Further Information and Feedback:

Jeannette A. Hovsepian, M.D.
E-mail: frensasc@ix.netcom.com
Phone:  +1 650 367 6483